HOME > 研究支援 > 分与可能なprimerのシーケンスとlist > FBN1


FBN1 PCR Primer
TargetPrimer nameSense primer (5'->3')Anti-sense primer (5'->3')Product size [bp]Annealing temperature[oC]
Exon 1r1gcgcacgggttgggcttgggaatggacgaacggggtggggactaaacaac59566
Exon 2r2ggccatctcttcctcttcttcttttttttaaagtatggcaaaaggccacattctaaggctc22760
Exon 3r3gatagcaaagtttgtgagggacctgagggcagaacagagaaggcagatg34765
Exon 4r4tgtgagctgttgcaatctatgcgaagaaaatccatcagcacttatctc24860
Exon 5r5ccttccagaggaccacaagtgttaccaggaagtagccatgcagacc26960
Exon 6r6cctctgcatgatggttcctgcccagagcaaataagattaatccattaataattcc30960
Exon 7r7atatggtaacataattgtggacTTTGCCTGCCCCCACTACACC27460
Exon 8r8ctactgacgaatggttttatattgtgttctacttgttatggaactgacttacacaaaccatg24360
Exon 9r9ccagtgtgaagtatggagctgcatctgcatcatgcacattgcc33260
Exon 10r10 ggatgacttctgtgggcctatgtctctggagaataggaagcctccc46560
Exon 11r11 tgctctgttgtcaccagacggggtaagttgttacagcagca37860
Exon 12r12 ggaacccagaaagtcttagaattatgaggccatggaactcctttgaagcc26760
Exon 13r13 caagatcatgagtttgcaaatggaggaatatcatggaaaattaggcttc37460
Exon 14r14 tgtcccatcttctccttccttaggtactttaagtggggagaatc39760
Exon 15r15 gctgcatattatttcctatcctgaccctgttggtttgttgctc37660
Exon 16r16 tgagttacaccagggatgatggctgtgaattccacaaatgcaaagacctc 34160
Exon 17r17 ggtgtaaggtgactccctgg gcatcccagatacatggcacagtg35260
Exon 18r18 ttcctcctgtagctcctaagg ctctaagctactcaaaggcag33060
Exon 19r19 gcttgaattgatcacgtcgttatgaccaggagactctaattcagtc32460
Exon 20r20 gcaattggggtcaaagttgaagcttttgcaggaaaagctgac27660
Exon 21r21 cttaatgtcagcttttcctgcctttgaaaattctcatgtgagcctag40260
Exon 22r22 ctatgtcagaactgcaaagtctgggacagctttatccagtccgag20760
Exon 23f23 gttttatgaacttaccaggttcaccgaagctaagtgctcag33260
Exon 24f24 cagcaaattattatgtgtgcagatcaagtagagtgctgagatc41860
Exon 25f25 caagaacttccaaccttcatgacagccttaattcttgcgaca31360
Exon 26r26 cttaagggccaggagaggg acctggaaqcataggctatgag32155
Exon 27r27 ggaggagtgcttggtctggcaaacataagcttccaactttggc27660
Exon 28r28 cgtgtatcggtaaggagaaagacacaaaactcagagtacatagag37360
Exon 29r29 gccctgcctcttaaatagtggactcaagcctgcttgactcc32660
Exon 30f30 aatagtcttatgctagtaggcggaatctttctatcactgaccc33560
Exon 31r31 gttattatgtctcgaggggaaagcatgtatcaatctataattatgataccaatctc27660
Exon 32r32 caggacgccaaaagacatttgtgctgagcctaacagaaagggtggtatttaaaacc30660
Exon 33r33 gtaggaaagtaacagaggttgcaatgtggaatgcctggcttctctgactagtg33060
Exon 34r34 cattgctgcactggaaagttgcaggaatgtttaaataacctaatctc28160
Exon 35r35 gtctataggagaagtgcccaggcccttgtgtagtcccag34860
Exon 36r36 tatctctgaagtggaagactgctgagaatggaatgtttggtgctg35660
Exon 61 r61gccttatttggccttttccgagttatccgatgatgaaggtgccaatagcc31460
Exon 62 r62ggtagaataatgtgtaggatgtggggtttcaaccaggttaggg36760
Exon 63 f63caagtggccagatccaatgcaaaaagcatggttctcctctgc41760
Exon 64 r64ctcacaactgcaaggaacaggctccttggaggaaaccacagg35060
Exon 65 r65agtgtatgcagcataaggcagttgtgaagtggaggtagctg349 60
Exon 65 r66bttccagctcttacaactctgacgtcacctgtaccttgctttgg43960

FBN1 Sequence Primer
TargetPrimer nameSequence
Exon 1r1f gcgcacgggttgggcttgggaatgg
Exon 1 r1rcacgaacggggtggggactaaacaac
Exon 2 r2f ggccatctcttcctcttcttcttttttttaaagtatgg
Exon 2 r2r caaaaggccacattctaaggctc
Exon 3 r3f gatagcaaagtttgtgagggacctgag
Exon 3 r3r ggcagaacagagaaggcagatg
Exon 4 r4fntgtgagctgttgcaatctatg
Exon 4 r4rncgaagaaaatccatcagcacttatctc
Exon 5 r5f ccttccagaggaccacaagtgttac
Exon 5 r5r caggaagtagccatgcagacc
Exon 6 r6f cctctgcatgatggttcctgc
Exon 6 r6r ccagagcaaataagattaatccattaataattcc
Exon 7 r7f_seqtttttctctctgtcttctgtaatctga
Exon 8 r8f ctactgacgaatggttttatattgtgttctac
Exon 8 r8r ttgttatggaactgacttacacaaaccatg
Exon 9 r9fbccagtgtgaagtatggagctg
Exon 9 r9r catctgcatcatgcacattgcc
Exon 10 r10fbggatgacttctgtgggcctatg
Exon 10 r10rbtctctggagaataggaagcctccc
Exon 11 r11ftgctctgttgtcaccagacg
Exon 11 r11rgggtaagttgttacagcagca
Exon 12 r12fggaacccagaaagtcttagaattatgagg
Exon 12 r12rccatggaactcctttgaagcc
Exon 13 r13fbcaagatcatgagtttgcaaatggag
Exon 13 r13rbgaatatcatggaaaattaggcttc
Exon 14 r14fbtgtcccatcttctccttccttag
Exon 14 r14rbgtactttaagtggggagaatc
Exon 15 r15fgctgcatattatttcctatc
Exon 15 r15rctgaccctgttggtttgttgctc
Exon 16 r16fbtgagttacaccagggatgatgg
Exon 16 r16rctgtgaattccacaaatgcaaagacctc
Exon 17 r17fggtgtaaggtgactccctgg
Exon 17 r17rgcatcccagatacatggcacagtg
Exon 18 r18fttcctcctgtagctcctaagg
Exon 18 r18 ctctaagctactcaaaggcag
Exon 19 r19fgcttgaattgatcacgtcgttatgac
Exon 19 r19rcaggagactctaattcagtc
Exon 20 r20fbgcaattggggtcaaagttgaag
Exon 20 r20rcttttgcaggaaaagctgac
Exon 21 r21fbcttaatgtcagcttttcctgc
Exon 21 r21rctttgaaaattctcatgtgagcctag
Exon 22 r22fctatgtcagaactgcaaagtctgg
Exon 22 r22rgacagctttatccagtccgag
Exon 23 f23 gttttatgaacttaccaggttc
Exon 23 r23 accgaagctaagtgctcag
Exon 24 f24 cagcaaattattatgtgtgcag
Exon 24 r24 atcaagtagagtgctgagatc
Exon 25 f25 caagaacttccaaccttcatg
Exon 25 r25racagccttaattcttgcgaca
Exon 26 r26fcttaagggccaggagaggg
Exon 26 r26racctggaaqcataggctatgag
Exon 27 r27fbggaggagtgcttggtctgg
Exon 27 r27rbcaaacataagcttccaactttggc
Exon 28 r28fcgtgtatcggtaaggagaaagac
Exon 28 r28racaaaactcagagtacatagag
Exon 29 r29fgccctgcctcttaaatagtg
Exon 29 r29rgactcaagcctgcttgactcc
Exon 30 f30 aatagtcttatgctagtaggc
Exon 30 r30rbggaatctttctatcactgaccc
Exon 31 r31fgttattatgtctcgaggggaaag
Exon 31 r31rcatgtatcaatctataattatgataccaatctc
Exon 32 r32fbcaggacgccaaaagacatttgtgctgagcc
Exon 32 r32rctaacagaaagggtggtatttaaaacc
Exon 33 r33fbgtaggaaagtaacagaggttgc
Exon 33 r33rbaatgtggaatgcctggcttctctgactagtg
Exon 34 r34fcattgctgcactggaaagttg
Exon 34 r34rbcaggaatgtttaaataacctaatctc
Exon 35 r35fgtctataggagaagtgcccag
Exon 35 r35rgcccttgtgtagtcccag
Exon 36 r36ftatctctgaagtggaagactgc
Exon 36 r36rtgagaatggaatgtttggtgctg
Exon 61 r61fbgccttatttggccttttccgagttatcc
Exon 61 r61rbgatgatgaaggtgccaatagcc
Exon 62 r62fbggtagaataatgtgtaggatgtg
Exon 62 r62rgggtttcaaccaggttaggg
Exon 63 f63 caagtggccagatccaatg
Exon 63 r63rcaaaaagcatggttctcctctgc
Exon 64 r64fctcacaactgcaaggaacaggc
Exon 64 r64rbtccttggaggaaaccacagg
Exon 65 r65afgtgtatgcagcataaggcag
Exon 65 r65arttgtgaagtggaggtagctg
Exon 65 r65bfttccagctcttacaactctgac
Exon 65 r65brgtcacctgtaccttgctttgg


